Complete Record

Back to Search Results

Line  ID
ws0113 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Ubiquitous
(1  dpf)
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' TGCCAGCTTGGATCGACATGACATGTCTTTTCCTTCATTT
TCATTTCTCTTTCTTTCTTTCTCCCTCAAACAGAAAATGA
GTACCGGGGGAAACTCCTGAACCAGCGCTGGACGCGAGGA
GACAAGATCAGCCGCTGCCGGCCCTCCCTCAGACTGCAGA
GCCGACCAATCAAAGTGAGTCTCACCAGCCAAACGGCACG
CACAAACACGGGCTTCAAGCCAAGCTGGCACAATTAGGGG
CAAAAGAGGACTATACGTTTATGACATTCATCAGTTCTGT
CTGTCAGCACACTGTGAAAGGAAGTCGGCGTTGTATTACC
GCAATGTGCGCAGTTCATGCCAGCTTGACCTAGAATGGGT
TTTTGGC
AGCTGGCA
(Reverse complement)
23:7897653-7898023(Reverse) intron  2 myt1b  [myelin  transcription  factor  1b] ENSDARG00000089464 [ZDB-GENE-090313-67]; Zv  version:  zv9