Complete Record

Back to Search Results

Line  ID
ws0146 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' ctcaaaNgtgtCattagtttgAcgtgttTCCCCCCCttAc
aCATCAacttttgNAaAGCGTCtgcttCacAtCgctctgt
CagaatcCttgcttgtaaAATACACTTTAGAACGCTTAAA
GCAAATTTGATGAatgtgATCAtgCgtgttGATCTGGAGA
GAGTCGCTCTCGCTCACTGANNNNNNTGTACTGCGTACAT
TGCGTGCGTTTGTTCCCTACGCAACAAGAACAAACGCCTG
ACATCGCCTGTCTGTATTCCTCAAAGCTGTTTAGAATTAA
ATGTTTAGAGGATGGTGTGACAACGTGTACCTATGTGTGC
CTTTGATGCACCCCTTGATCCTTCTTATGTCCTTGTCGCA
GCACCAGTTGCTCCGAAATTAGGCACCGAAATTCATAAGC
TGATTTGGTCTGGGACATATCGGTTACTAAAGTACGATGC
TATAATGGCACCAAGTTTCAAGTACCCAACCCTACCGGGC
TGTCCTTTTTGTTGAGCCCTGTAAAGTGAGTAAACTCATC
GTAACTTGGTAATGTTAAGCTGACTTTACTCAAAGGGAAA
AAAGTTGCCTAAAATTAAGTGAAGCCAGCTGANNGCCCTT
TACTGCATTTTACAATGAAGTTTATTCCATGTATTCCATG
NTGGA
cNtttgag
(Reverse complement)
14:53609430-53610173(Reverse) 12146bp  downstream polr2b  [polymerase  (RNA)  II  (DNA  directed)  polypeptide  B] ENSDARG00000012592 [ZDB-GENE-041008-1]; Zv  version:  zv9
3' gctggAACCGAGGGATCATCAGGATGAAAAGAGAGGTATA
GCTGGGTATCATCAGCATAGCAGTGGTAGGAGAATCCATG
TCTCTGGATGACTGTTCCtAgAgATGACGTGTAGATGGAG
AAGAGAAGTGGCCCAAGAACAGAGCCTTGAGGTACTCCAG
TGTTTAGATGCTGTAGGTTGGCCTCTCCCCTCCAAGACAC
CCTGAATGGCCTGTCAGAGAGGTAAGATCTGAACCATTGT
ATAACAGTGACCGCAACGCCCAGTGACTCGAGCGTAGATA
GCAAGATCTGGTGGTTGACAGTGNCNNNNGCANCTGACAA
GTCCAGCAAGATGAGGACTGATGATTTTGAGTCTGCTTTA
GCCAGTCTGTGCTCCTCCTCAAA
gctggAAC 23:10623533-10623910(Forward) intron  3 tenc1a  [tensin  like  C1  domain  containing  phosphatase  a] ENSDARG00000076292 [ZDB-GENE-090312-163]; Zv  version:  zv9
3' cCTGGAACCGAGGGATCATCAgGATGAAAAGAGAGGTATA
GCTGGGTATCATCAgCATAGCAGTGGTAGGAGAATCCATG
TCTCTGNTGCTNCaCAAtGgAAAGCCACACTGCNCCTGCA
CaCagCTAACGCTACAGAAATCTAACTAAAACACaTCTGG
GTGATATTTCAGCGCAtAATATGAAGTTTAATATAGCTAA
tATTTATANGATCAAA
cCTGGAAC   [] ; Zv  version:  zv9
Unmapped  sequence
5' cccaagGNGcCATaANTTTGACNNGtTNCCCCCCCTTAca
CNTCacNTTTTGaaAAgggccgGcTTCtctTCCNNcNgcC
aAANNCNTtGtTTGaAaaaaANNNTTaAAANccTTNAagN
NaAtTTtaAgaANgGNNNcctNNNNGGTNAACTGGAAAAA
A
NCcttggg
(Reverse complement)
  [] ; Zv  version:  zv9
Unmapped  sequence
3' CATTTGAGGACTCATAATCAACCTAAAGGCAGAGGAATGC
ACCGTCTCTGATCCTCCTCAANNNGGNAGGAGAATCCATG
TCTCTGCT
CATTTGAG 14:53610166-53610216(Forward) 12882bp  downstream polr2b  [polymerase  (RNA)  II  (DNA  directed)  polypeptide  B] ENSDARG00000012592 [ZDB-GENE-041008-1]; Zv  version:  zv9