Complete Record

Back to Search Results

Line  ID
ws0294 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Ubiquitous
(1  dpf)
Ubiquitous  GFP  and  Cherry  expression
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' CCCATGAGAAGTCCCCACAAAACATGACAACCCATCGTGT
GTGTGTGTGTGTG
CTCATGGG
(Reverse complement)
3:23631803-23631855(Forward) intron  14 RAPGEFL1  [similar  to  Rap  guanine  nucleotide  exchange  factor  (GEF)-like  1] ENSDARG00000079912; Zv  version:  zv9
3' CTCATGGGCGTAATATTGAATAGACTGCATATTCTGTCCT
CTTACCCCAACTTTAACACAAGACCCAACCCAACATTTTC
AGAATACTTCCTTTTTTGTGATCTATGAGCCATTAAAAAA
AAACTGTTTAAGGTCTGGCATTACAGGGTAAATTAAATGT
GTAAAACATAAACAAACAAAAAAATATCTACTACAACTTC
CAGCAAGTCTAAACAAACTGTAAAACTTTCAGTGTTGTCT
TTGGGTGATACTTGATTGATTTCTTGCTTCATCACA
CTCATGGG 3:23631537-23631810(Reverse) intron  0 RAPGEFL1  [similar  to  Rap  guanine  nucleotide  exchange  factor  (GEF)-like  1] ENSDARG00000079912; Zv  version:  zv9