Complete Record

Back to Search Results

Line  ID
ws0308 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Muscle Larval:Day5
(5  dpf)
Lateral Fast  muscle
Neural  Tube
Muscle
CNS
Larval:Day5
(5  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' NNNNNNNAGNNNNGGATGCCNTTCCAGCTGCAACTCANNA
CTGGGAANNNANCNTTTACATACACTANNCNCACATCTGC
TACANCCAATTTAGTTTATCCAATTTACCTATATGTCTTT
GNACTGNGGG
TNNNNNNN
(Reverse complement)
12:8179498-8179614(Reverse) intron  3 phyhiplb  [phytanoyl-CoA  2-hydroxylase  interacting  protein-like  b] ENSDARG00000070498 [ZDB-GENE-040927-27]; Zv  version:  zv9
Also  detected  in  Line  ID  ws0435
3' CATCTCAATCTAGAATTAATTTTTTTAATCTAGCATTTTT
TGACAGATTATTGAGTAATTTCTATGAACTCCACCAAAAT
ACCAAACTCTTACATTGTTTGTTCATGTCCCACCCCTCAA
TGCTAGTCCAAATCCATCCAAACCCACATAAGCTCCCTTG
CCTCCTACCTTGGGACGTTTCCAGACGATGTTCTTGACTT
TGTTAGACTTGTGTCCCAGTTCTTTATAGCCCAGAGAGTC
CACAGTAGCAGGGAAGGTCTCGTCCTCGAACAGGGTCTTC
TTCTGGAGATACTCCTGCTTGAGGAGGGTGTAGTCCTGGC
CACTGAAGCGAATGGGTTTGCTCAGCGACCCTTCGCCATC
CCTTCTCTCCCTCTCCCGAATTAAACGGNCGC
CATCTCAA 17:45472758-45473148(Reverse) intron  0 capn3a  [calpain  3,  (p94)] ENSDARG00000041864 [ZDB-GENE-040912-97]; Zv  version:  zv9