Complete Record

Back to Search Results

Line  ID
ws0003 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Neural  Tube
Intestine
Intestinal  bulb
CNS
Gut
Larval:Day5
(5  dpf)
Lateral
Muscle Pharyngula:Prim-15
(2  dpf)
Lateral
Eye
Cerebellum
Intestine
Muscle
Neural  Tube
Intestinal  bulb
Brain
CNS
Gut
Larval:Day4
(4  dpf)
Lateral
Eye
Optic  Tectum
Cerebellum
Neural  Tube
Muscle
Otic  vesicle
Brain
CNS
Ear
Pharyngula:Prim-5
(1  dpf)
Lateral
Pronephric  duct Larval:Protruding-mouth
(3  dpf)
Lateral
Cerebellum
Eye
Tegmentum
Olfactory  placode
Brain
Pharyngula:Prim-5
(1  dpf)
Lateral Olfactory  placode
Tegmentum
Neural  Tube
Notochord
Pronephric  duct
Muscle
CNS
Floor  plate
Pharyngula:Prim-5
(1  dpf)
Lateral
Pectoral  Fin Pharyngula:Prim-25
(2  dpf)
Dorsal
CNS
Ear
Iris
Intestinal  bulb
Larval:Day6
(6  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
3' CTTGCACATCAATATTGCCAGCACAAAGTGAAGTCATAGT
TTAATCAGAGTTATTAAGCAGCTCTCCCTCACACTCCAGA
TGAGACACGAAACAAACTCAGAGACTAACACTACACCCAA
TGCTCGACATAAAAGCAGGATCAACACGTCAGAGTAAAAA
TGTGAACACACAAACTTCTGTCTCATTTAGAGAGCGTTTA
GAGACTAAAAACTTAAAGCAAACAGTACACACAAAAGTAA
CTGCGAGTTTAAAAGGTGATTCAGAAAGCTTCTGAATTCA
TGTTTAAGAGCCATGCACAAGCAAATCCACACACACACCG
CTCTATTAAACCAGAGGAGTAAAAGCAGAGAGATGTTTCT
GTTCTTACCTGAGCTGTGAGAGTGTGTGATGCACCTGTGC
AGGTGGAGGAGGAGCTTATATACTCCTGCAGCAGGACNCA
CACACTGATCTAAAGTCCACAGCAGCGGGTGGATCTTCAG
AGCATCTCAGACACACACACATAAACAGACACGCACTTTA
TGTACTCTAAAAATAAACGTGCAAATGAATCTCT
CTTGCACA 23:1084682-1085275(Reverse) intron  0 slc34a2b  [solute  carrier  family  34  (sodium  phosphate),  member  2b] ENSDARG00000036864 [ZDB-GENE-030709-1]; Zv  version:  zv9
3' ACTGCAGGAGTCAATAATGTTTGATCACAAAAACAGTCAT
CCACAACTGCGCCGCCGCAGTCCGGCAACCCGCGCAGACA
GTGATGAATGGAAACAAATTTTCTTTCGCATGCTAACAAA
TAAAAAACCACTCTAAATTACTGATTAACCGCATTCCCAT
TCACAACTGACACCTGAATCTTAACCTCAATGAAGCAGTC
ACTATGTCTCTAAAAAGCTTTCCTTTTTCCGATATTCTTG
CTCCAAGAGAAAAGAACACAAATCCCAGTGTAAGCGAGTC
CTTTAGGCAAATGAGTGCATTGTAGAGAGACAATCCAGCA
AATGCTTCAGTTAAATCCGACACAATGTTCGCTTTGTTTT
GGCAATATGCAACCAGACGTTCTTTCTGTCAGCGCCAACA
TGATGTCTTAACTTCATTAGAGGAGAAAGTCGCATTTATC
AACTTCACAGAATCCACAGCTTGGACTGCCAAGATAGCAA
CAAAACAATAATAATAAGGCTTGATGTCTTTGTTTTTCCA
AACTAGTGGGGGTTACGCCAGATGCGTATCTTGAAAAATA
AGGCTTCATAAAATGTCAACACCTGATGTGGGGCTTGATA
TTGCGAGCTGCGGTTTTATCATACAGGTGTGCGTTTCTCG
AT
ACTGCAGG 24:5790114-5790755(Forward) intron  0 C24H3orf58  (2  of  2)  [Chromosome  3  open  reading  frame  58] ENSDARG00000055629 ; Zv  version:  zv9
3' TGCAGATTAGGAAGGGAAGTGGAGACTAAATAGTTTTTAG
TGGTTAGTGCGTCNACACATAGCACCAAGGTGCTCACTGC
GACCTGAGTTCGATTCCCGGCTCGAGGTCCTTTGCTGATT
CTTTCCCCTATCTCTGNTCCTCCNCANANAACANNTCNGG
GTGATATTTCANCGCATAANANGANGNTTAATATANCTAA
NATTTATANGATCA
TGCAGATT   [] ; Zv  version:  zv9
Unmapped  sequence
5' CCGCCCCTGCCTGCCACTTAGCTACCTATCTGCAGCCTGC
CACCTACCTAGCTTCAGCCTGCATCTTATATATATTATAG
GTAGATACAGACTGGTACAGACTGATGTGACTGGAGTGGg
gttgggggtgNNNTATTNCTACA
AGGGGCGG
(Reverse complement)
  [] ; Zv  version:  zv9
Ambiguous  mapping