Complete Record

Back to Search Results

Line  ID
ws0075 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Pronephric  duct Larval:Protruding-mouth
(3  dpf)
Dorsal
Nose
Neuron
Larval:Day5
(5  dpf)
Dorsal
Neuron Larval:Day5
(5  dpf)
Dorsal
Neuron Larval:Day5
(5  dpf)
Dorsal
Muscle
Pronephric  duct
Larval:Day6
(6  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' GtCATTGTCGGCGAATTGCTTGTCGTCATCGTCTTTGAAA
CGACCT
ACAATGaC
(Reverse complement)
  [] ; Zv  version:  zv9
Unmapped  sequence
3' ATATGACTACTGCGAATGATCGCATAGCGATATATTCATT
CATTCATTCATTTTCTTGTCGGCTTAGTCTCTTTATTAAT
CCGGGGTCGCCACAGTGGAATGAACCACCAACTTATCCAG
TAAGTTTTTACGCAGCAGATGCCCTTCCAGCTGCAACCCC
TCTCTGGGAAACATCCACACACATTTACACACAATTTAGC
CTATGATATGATTTCAAACATCTTACATCAAACATCTGAA
AACATGAACTCAACAGAATAGTGCACAGTATTTTACAGGT
CATAATATTATTTATCATTATAAAATTCTGCCTCTGACTT
CAATCACTTTCAATAATGGTTATACATGGCTGCTTAAAGA
ACATTCAAAGAATCTTCTATTCCACAAAATAATCTTTATA
GTAAGCATTCTTTAAATGTCCTTTAGATTTTTTAAATATT
CTTAGTTTAATGGAGANTTTATTCNNATATTGAGCACTAA
AGTNGCAGGTTTCCAATCACCCCAAAAAAATAC
ATATGACT 8:27683238-27683750(Forward) intron  0 si:ch211-156j16.1  [si:ch211-156j16.1] ENSDARG00000092035 [ZDB-GENE-030131-4106]; Zv  version:  zv9
Also  detected  in  Line  ID  ws2254
5' TCTATCCCTGGACTTGCAGTAGAGGCCCCAGGGTGCTCCC
TGGCCCCCCGCCTAGGGGCCTCTGACCCCAGCAAGCTACC
CAGGGGTTCACCTCTCTCCCTGGACTTGCAGTAGAGGCCC
CAGGGTGCCCCCTGATTCTCCACCTAGGGGCCTCTGACCC
CAACGAGCAATAGCAGAGAGCGGCCGCTCTCTGCTATTGC
TCGTTGGAAAACGAAAGACACACTGACATAGTGCTTTTTC
CACTAAAAGTTGACTTTCACAGCATGTAAAAACACGTTCA
CGACCATTAGTAAACAATTCAAAAGATGTGTCTCTCAATG
CAAAAAGTGGGTTCAGTGTGATCAGGGTCTAAAGCCTGGT
TTATACTTCTACNTCNAGTGACCGGNGTAACCCNTGGNGC
ATGCNNTGNNCGTANCTGNGCNTTTATATTTCTG
GGGATAGA
(Reverse complement)
  [] ; Zv  version:  zv9
Unmapped  sequence