Complete Record

Back to Search Results

Line  ID
ws0174 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Eye
Optic  Tectum
Neural  Tube
Cerebellum
Hatching  gland
Brain
CNS
Lens
Hindbrain
Otolith
Pharyngula:Prim-25
(2  dpf)
Lateral Hatching  gland
Neural  Tube
Muscle
CNS
Pharyngula:Prim-25
(2  dpf)
Lateral
Notochord
Blood  vessel
Pharyngula:Prim-25
(2  dpf)
Lateral
Muscle Larval:Day7
(7  dpf)
Lateral
Eye
CNS
Hatching  gland
Larval:Day4
(4  dpf)
Lateral
Notochord Larval:Day5
(5  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' ATTATATAGTAGTCAACATTGATTGATTATAAAGGTTTTT
CATTTTGTCCTACNAAGCAATAATGGGTGTTG
TATATAAT
(Reverse complement)
7:56777139-56777210(Forward) intron  0 piezo1  [piezo-type  mechanosensitive  ion  channel  component  1] ENSDARG00000076870 [ZDB-GENE-041111-255]; Zv  version:  zv9
3' GTTTGGTCATGTTGTACNGNCGTCTGGANGTTTACTGAGG
CCNTATNGTGGTTTCTGCCTCCTTCNANNGNGANTGGNAN
NATGNATTTGTT
GTTTGGTC 21:17731631-17731722(Forward) intron  9 smpd4  [sphingomyelin  phosphodiesterase  4] ENSDARG00000020730 [ZDB-GENE-040426-2672]; Zv  version:  zv9
Also  detected  in  Line  ID  ws0310,  and  ws0509