Complete Record

Back to Search Results

Line  ID
ws0188 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Eye
Forebrain
Midbrain
Midbrain-Hindbrain  boundary
Brain
CNS
Neural  Tube
Lens
Cerebellum
Hatching:Long-pec
(2  dpf)
Lateral
Tail  Fin Larval:Day5
(5  dpf)
Lateral
Tail  Fin Larval:Day5
(5  dpf)
Lateral
Eye
Forebrain
Midbrain-Hindbrain  boundary
Midbrain
Neural  Tube
Brain
Lens
Cerebellum
CNS
Nose
Hatching:Long-pec
(2  dpf)
Lateral
CNS
Pectoral  Fin
Pharyngula:Prim-15
(2  dpf)
Dorsal
CNS
Optic  Tectum
Rhombencephalon
Pharyngula:Prim-15
(2  dpf)
Dorsal
Pectoral  Fin Larval:Day5
(5  dpf)
Dorsal
Ceratohyal Larval:Day5
(5  dpf)
Pectoral  Fin Larval:Day5
(5  dpf)
Dorsal
Liver
Lens
Eye
Ceratohyal
Hindbrain
Larval:Day5
(5  dpf)
Lateral Tegmentum
Liver
Muscle
Larval:Day5
(5  dpf)
Ventral
Muscle
Neural  Tube
Pronephric  duct
Pectoral  Fin Hatching:Pec-fin
(3  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' CCTGTAAAACAGACATTAGCCCCTTTCACACAGTGATACC
GGTAAATATCCGGAAAATTTCCGGAACGACTTTACCGGTA
TATTCAAAAAAGCGCTGTTCACACAGGCGAGGACGTTACG
GAAATTTTCCGGAAAAGAGCATTCACACATCCATTCCAAA
ATACCGGTAAATTCTGACATCATTCACCACAGATGAGCTT
TAAACGGCTGCGCTTGTATTTGTAAACATTTGACTACATT
ACAAACTCTGTGGATGATCAATATTGTGAACAACTTTCGC
AGGATCACTTTTGCATGTCGAGATGTTCATAATATGTGCG
TGTGCAGGCGCTCATAGGCGCACGCAAAGCTTGAAGGTAA
ACAAACAACAGCTTATCATAACATCTCATCGATGATTATT
TAC
TTTACAGG
(Reverse complement)
6:22083122-22083524(Forward) 182416bp  downstream aanat1  [arylalkylamine  N-acetyltransferase  1] ENSDARG00000036567 [ZDB-GENE-040329-1]; Zv  version:  zv9
3' CATCTAATCAACTCTTTTAATACCACCCCTTTTCGAGCGC
CATGAGACAAAATTTTGCATGTTCAAACTCTAGTGTGACT
GCGACTTGAAGCTGTTAATGTTTACACTGAGAGATTTAAG
CTGCTCTCTGCTCCTCCACAANNTGCNTTGCNCTCACTGC
CCGCTTTCCNGTCNGGAAACCTGTCGTGCCNNCTGCATTA
ATGAATCGGCCAACGCGCGGG
CATCTAAT 12:8084794-8084923(Reverse) intron  11 bicc1b  [bicaudal  C  homolog  1b  (Drosophila)] ENSDARG00000070497 [ZDB-GENE-080522-3]; Zv  version:  zv9
3' TTCATATGTGTATATAAATCGGATATGTGATAATTTGACT
ATTGTAAACAGGCAGATCAGATGTATTGAGGTATTCCTTT
TTGTACATCATTAAACTTGTGACAATGTGATACTTCACCA
TAGTTTAATGATGTAGAATGAAAAGCGTGTGTG
TTCATATG 7:50364501-50364666(Reverse) 31188bp  downstream igf2a  [insulin-like  growth  factor  2a] ENSDARG00000018643 [ZDB-GENE-991111-3]; Zv  version:  zv9
5' CAGCCCAGTCACCAGATACATACATTATTGAACATATCTG
AGGTAAGCTGGAGGAGGCATTGAANATGAATCCAAGGAAT
CTTGATGAACTTCTATTTCAGTTAAGTGGCAAGACTTTTG
TCTAAGCAAAGTCAGGCAATACTGTCCTAATTAAATAATT
AAAAGCCATGATCATATTTTGAAAAAATAAGCGTAATCTA
GAGGCCTTTACCTTTCATATAAGACAGGGATGNNNNNNNN
CNGNCTCTGNGGATGATCAATATTGTGAACAACTTTCCCA
GGATCACTTTTGCATGNCNAGATGTTCATAATATGNGCGT
GTGCNGGCGCTCNTANGCGCACGCNAAGCTTGAANGTAAA
CAA
CTGGGCTG
(Reverse complement)
25:19100906-19101137(Reverse) intron  2
  AND 
  intron  1
cav1  [caveolin  1],
met  [met  proto-oncogene  (hepatocyte  growth  factor  receptor)]
ENSDARG00000052004 [ZDB-GENE-030131-2415]; ENSDARG00000070903 [ZDB-GENE-041014-1]; Zv  version:  zv9
5' GTGTGCATAAACTTTGTGACATTGTGTGTGACTTGCAAAA
TGGCTTGAATTAACTCCACAACAAATACATCAAATAATAA
TTGGGAAAGTTCTTACTGTAGTATTTATTACAAATGTTAC
GCGAGATCTGCTTTGTTCATTTCTGGCACTGTGCTGTTTA
TCTGACGCAGCCGAGTCGGAGATTAAGACTCACTCTGACA
GGCACATGGTAATGGTGGGCAGGGAGAACAAGCATTAAAG
GCACAGAACTACCAAGA
ATGCACAC
(Reverse complement)
24:15866907-15867152(Reverse) intron  3 neto1l  [neuropilin  and  tolloid-like  protein  1-like] ENSDARG00000071596 [ZDB-GENE-091207-1]; Zv  version:  zv9
3' CCCAGGGGTCCACCTCTCTCCCTGAACTTTTAGTAGAGGC
CCCAGGGTGCCCCCTGGCCCTCCACCTAGGGGCCTCTGAC
CCCAGCAAGCTACCCAGGGGTCCACATCTCTCCTTGGACT
TGCAGTGGAGGCCCCTGGGTGCCCCCTGGCCCTCCACCTA
GGGTCCTCTGACCCCAGCAAGCTACCCGGGGGTCCAGCTC
TCTCCCTGGACTTGCAATAGAGGCCCCAGGGTGCCCCCTT
GCCCTCCACCCAGGGGCTACTGACCCCAGCAAGCTACCCA
GGGCTGTAGCTCTCTCCCTGGACTTGTAGTAGAGGCCCTA
GGCTGCCCTCTGTCCCTCCACCTAGGGGCCTCTGACACCA
GCAAGCTACCCAGGGCTTCACCTCTCTCCCTGGACTTGCA
GTAGAGGCCCCAGGGTGCCCCAAGGTCCTCCACCTAGGGC
CCTCTGACCCCAGCAAGCTACCTAGGGCTCCACTTCTCTC
CCTGGACTTGCAGTANAGGCCCCAGGGTGCCCCCTTGCCC
TCCACCCAGGGTCTACTGACCCCAGCAAGCTACCCAGGTC
TGCACCTCTCTCCCTGGACTTGCAGTANAGGCCCCAGGGT
ACCCTGTGGCCCTCCACCTAGGGGCCTCTGANCCCAGCAA
GCTACTTANGGGTCCACATCTCTTCCTGGACTTGCAGNAN
AGGCCCCNNNNACCCCGTGNNCCTCCACCTNGGGGCCTCT
GANCCAGCAAGCTACCCNGGGNTCCAGCTCTCT
CCCAGGGG Zv9_NA294:10408-11164(Reverse)   [] ; Zv  version:  zv9
3' GCACAAGACACCAACAAAATTGAGGTTTACAGATGAAGTG
CAGCTGATCTGTGACGCTCTTTTTCCAGAGGTATGCCAGA
CCAAATAATGCACTTACAAAATCTCCTGTACATAAATTGC
ATGCTGGGTGTTACTCATTTATCGACCCATGTATGATGAT
ATTTGCAGTTCAGTAGTGGTATATTAGTTCATTTAAATGA
CTCATTTTTTTCATAGGCCATCATACATGCTTTGGGGGTC
TTGAGGGGTTTGTCTTCAGATGATGCTAAGCAGGTCTACC
TTTCTGGCACAAAATATCATTACAGGTCAGAATATAAGTT
ATTTTAGCATAATGCTCAGAGAACCTTTTTGTTACTTATA
TTTACATTAACCCATNTGG
GCACAAGA 6:22056326-22056700(Reverse) 209240bp  downstream aanat1  [arylalkylamine  N-acetyltransferase  1] ENSDARG00000036567 [ZDB-GENE-040329-1]; Zv  version:  zv9