Complete Record

Back to Search Results

Line  ID
ws0224 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Eye
Lens
Midbrain
Midbrain-Hindbrain  boundary
Neural  Tube
Brain
CNS
Optic  Tectum
Hindbrain
Hatching:Long-pec
(2  dpf)
Lateral
Neural  Tube
Notochord
Muscle
CNS
Hatching:Long-pec
(2  dpf)
Lateral
Midbrain-Hindbrain  boundary
Eye
Iris
Brain
CNS
Cerebellum
Larval:Day5
(5  dpf)
Dorsal
Eye
Lens
Iris
Midbrain
Midbrain-Hindbrain  boundary
Brain
CNS
Larval:Day5
(5  dpf)
Lateral
Muscle Larval:Day5
(5  dpf)
Lateral
Neural  Tube
Notochord
Muscle
CNS
Larval:Day5
(5  dpf)
Lateral
Neural  Tube
Notochord
Muscle
Larval:Day5
(5  dpf)
Lateral
Ear
Iris
Eye
Otic  vesicle
Otolith
Larval:Day5
(5  dpf)
Dorsal
Eye
Lens
Midbrain
Midbrain-Hindbrain  boundary
Neural  Tube
Ear
Brain
CNS
Larval:Day5
(5  dpf)
Lateral
CNS
Neural  Tube
Larval:Day5
(5  dpf)
Lateral
Brain
CNS
Lens
Midbrain
Midbrain-Hindbrain  boundary
Neural  Tube
Hatching:Long-pec
(2  dpf)
Lateral
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' CCCACAGGGGCTATAAAGCTTAGCATGGTCCTCTTGGTGC
ACAGGGCAAAGTAGCTTTCATTTATGACATGCTTAAACAA
CCTGTTTGGCTAAGAGTGAATGTTAAATATGTGGGATTCA
CTGGAGGGAGAATCATTATTATTCACACTTCATCAGTCAC
ACAATGCCTCTCAGGCTGATCGGGCTTAAGCTGTCAAGGG
TGAAGAGGAAATGATTGTTTTCTTTCACTTTTATCTCATC
TCAGCTGCTCATTTGCTCATGCTAAGCATTTTTCATAATT
TTAGGACTAATTTTCCATGCTAAGAAGAAACGGTTCACGC
AGCACCAAAGCTGATGCTTACCTTGAATGAAACGTAAGAG
TAAAAAGATCCATCTTAAATTAACTTTCAGTGTAAAATGT
TGTTATGCCATAGAGATGCACTGCAAACCAGTGGTGAAAT
CCTAACAAAAGTTGGTGTATTATTACCCACCCAACCCAAA
TTTTAAAGGTGGGC
CCTGTGGG
(Reverse complement)
5:14284153-14284647(Reverse) intron  0 ypel1  [yippee-like  1  (Drosophila);  similar  to  Protein  yippee-like  1] ENSDARG00000035630 [ZDB-GENE-040808-41]; Zv  version:  zv9
3' CNNNNNGGAAAATGTACCATCTATTGGACAGCTGTGTTCT
AGGCATTGCAGTTTAGCANACCAGACTGTCAACGTATTAC
AAAGCCAAACATAACACTTATTTACAGCAGGTTACACTGT
CAATATTAACTAGAAAAGTAATGTTCGTAGACAAACGTTA
TGGTGTCTTGAGAAAGCCTCTTGTGAAAGTTTGAAGTAGT
TTCAAAGTTTAAATAACTGAAGAAGTTTAAGAAGTTTAGA
ACAGTCGGCGTAGATACATAACTACATATAGAATAGCATG
CTTCTAGTACAGATTGTCATGTTTCCTGCTAGGTGGTTGC
TAGGATGTTCTAAGTGGTTGCCAATCCGTTGCTAGAGTGT
TC
CNNNNNGG 5:14284646-14285001(Forward) intron  0 ypel1  [yippee-like  1  (Drosophila);  similar  to  Protein  yippee-like  1] ENSDARG00000035630 [ZDB-GENE-040808-41]; Zv  version:  zv9
5' CCAGCATGTAGACTGGACGTCTGTACCTGGGAGTTCCTTA
TTACGTCTCTGAGTGTGCTGCATTCATGCAGGAGTAAGAC
TTGGTTCAAACCAATCAGCGCGCTCTATTGTGTATGCGGT
GCAGCTTCATTAATATGCATGATCGCTTCCAAGACCAGTT
ACAGTATTCAGACAGCACAGAGACGCCACGTTGTGTTGCC
AAAACAAGCGGATTGAACAAAAATTGTTTGGAGATACGGG
TCGTCAGTGTTGTGTTTATAATGTGCTGCAGTGAAGGTTT
TGTTTTCATTTTCTCTCTATGAGAGCGCAGCTGGACTCAT
GTGTGGATCAGTGCACGTGACGCACGACAGAAATACGTGT
CTAAGGCTGCGTTCACACCTGTGAAACGATTCAGTTGTTC
TGAAACAGAGACTACAATTGTTACATTGTTGCTCTTTGCT
CTTGGAGCGGTTCGCTTTCACACTCCAAAGTTTCTAATCG
GACCAAAAGAGCTAAAACAAGTCACGTGTGAGTAAACTCT
CCTCACATTGGTCAGAGTGTCAGGGTTTATTTTGATTGAC
AGGGTGTGCGCGACGTGTCTGAGAAGAGATGCGGTGGGAA
GGGGTGAGAAGAGTGCGTGACGATGCCTATTTGAGGACCG
GGAGGTAGACGCGAGATTACCGGGAGATCATCACTCGTTT
GCGGGCATCCGGAGACTCGCGAAACTTCCCGCCCTACTCA
TAATTCTCTCTTCATATAGCCGTAAGCCTATTACATATCC
ATAAAACACTGTGATATAACCGCGCTCGGATCGGATCGCT
TTCTCAC
CATGCTGG
(Reverse complement)
19:46814873-46815642(Reverse) exon  3   [similar  to  RAS-like,  estrogen-regulated,  growth  inhibitor] ENSDARG00000041104; Zv  version:  zv9