Complete Record

Back to Search Results

Line  ID
ws0194 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Eye
Cerebellum
Pectoral  Fin
Branchial  arches
Optic  Tectum
Rhombencephalon
Brain
CNS
Lens
Larval:Day5
(5  dpf)
Lateral Rhombencephalon
Eye
Ear
Cerebellum
Rhombencephalon
Brain
CNS
Larval:Day5
(5  dpf)
Lateral Rhombencephalon
Cerebellum
Neuron
Brain
CNS
Hindbrain
Otic  vesicle
Optic  Tectum
Larval:Day5
(5  dpf)
Dorsal
Neural  Tube
Blood  vessel
Intersegmental  vessel
CNS
Larval:Day5
(5  dpf)
Lateral Intersegmental  vessel
Brain
CNS
Ear
Forebrain
Lens
Otic  vesicle
Larval:Day5
(5  dpf)
Dorsal
Brain
CNS
Hindbrain
Optic  Tectum
Larval:Day5
(5  dpf)
Dorsal
CNS
Muscle
Neural  Tube
Notochord
Larval:Day5
(5  dpf)
Lateral
Pectoral  Fin Larval:Day4
(4  dpf)
Lateral Endothelial  cells  in  pectoral  fin
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' GCTGTAACATTACACTCAATTTTGGAGCCTGTATCCCCTT
CCTTCTTTTTTGCAATAGTATGCCCTTTAATGTCATTCAC
TTGTGTTCCCTTAAGTAGTGTGGCTAAAGGCCATGCCCAT
GCACACGTACACCTGTGGTTGTATTAAATGAGTTTTCCCT
GCCTTCATTTAAAAAAAAACACACACATGAAAACACAAAA
CACTCTGTGATGCATGTTAAGGGCATGCTGAACCAACAAG
TGACAATAAAAGCCTTTTATGCCAGGTTCAAATAAAACGT
TGAATGAAGTATTTGTGTACATTGCATACAAGTCAATGCA
AATGTGAAAATTACTGTCCTGCAGTGCAAACGATGCAAAA
TATGTGAACATGTGAAATTTGCCTCATTCACATCTTCCAT
GTTTGGTGTAAACTCTGCCATGTTGGTTAATCATAAAGGA
GAAAACAGCGCCCACTCTGGCGTGTGGCAAACACTCTGGT
TGTAGTTTCCACACGACCACACTGTAACCACACTGTTC
GTTACAGC
(Reverse complement)
2:48859747-48860264(Forward) 5706bp  downstream CR391991.2  [Uncharacterized  protein] ENSDARG00000089752 ; Zv  version:  zv9
5' ATCTGCTGTGTAAAACATGTGCTGAATAAGTTAGCGGTTC
ATTCCGATGTGGCAACCCCTGATGAATAAAGGGACTTAGC
CGAAGGAAAATGAATGAATAGTCTAAAATCCATCTAAAAA
CCAGAGGTTCCGTTCTAGACCACTAGACGGCAGTATATGC
TCAACTCAGACCTTCAGAAACCACTGGAAACTACGAGAAA
GACTCAAATTTACTCAAAAAATGTGCTAATTAACCCACCC
TGATTTGAGACAGAAGGATTCATCAATCATAAATCTGTAT
TAAGTAATTTTTATAAAACTCCTCACTGCTAATTTGTATT
CTTTGTCTGTGTACAAAAACACATTACGCAGAGTTATGAC
CAGCTATTAAAACAGTTTGATTTTGAAGCAACATTTACGT
CACTGTATGACTTGCCGTTACTGTAGCGCAAAAATGCTGA
AAGAGAACTGAATTC
CAGCAGAT
(Reverse complement)
21:7839765-7840219(Reverse) 1917bp  upstream psmb7  [proteasome  (prosome,  macropain)  subunit,  beta  type,  7] ENSDARG00000037962 [ZDB-GENE-001208-4]; Zv  version:  zv9
3' TGTAAAACCACTATGTGCTGGGTGCGACGACATTTTGCCC
GCTCTTAAACAAGCAAAAAAATTAATACAGACACATTCTG
AGTGGTTCTGTGCC
TGTAAAAC 24:300252-300345(Forward) 16883bp  downstream impa2  [inositol(myo)-1(or  4)-monophosphatase  2] ENSDARG00000059411 [ZDB-GENE-050522-349]; Zv  version:  zv9