Complete Record

Back to Search Results

Line  ID
ws0157 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Branchial  arches
Lens
Liver
Midbrain-Hindbrain  boundary
Neural  Tube
CNS
Eye
Brain
Larval:Protruding-mouth
(3  dpf)
Lateral
Muscle
Neural  Tube
CNS
Larval:Day4
(4  dpf)
Lateral Fast  muscle
Eye
Lens
Larval:Day5
(5  dpf)
Ventral
Eye
Gill
Heart
Lens
Larval:Day5
(5  dpf)
Ventral Heart  epithelial
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
3' CTCAGACTTCCCTCTTCCCAGACACCCGAGGCATTCCCAG
GCCAGCCAAGAGACATAGTCCCTCTATCCCTCCAGCGTGT
CGTGCATCTTTCCCAAGGCCTCGTCCCATTGGGACATGCC
TGGTAAACTTCCCTAGGTAGGCGTCCAGGAGTCATCCGGA
ACAGATGCCAGACTTCTCTCGATGTGGAGGAGCAGCGGCT
CTACTCCGAGCTCCTCCCGGGTGTCAGAGCTCCTCACCCT
ATCCATAAGAGTGCGTCCTGCCACCCTGTGAAGAAAACTC
ATTTTGGTCGCTTGTAGAGTTTTTACACTTTTTTACTGTA
AACATTTTATAGTGTAACAATTAAGTATTAAGTAACAAAC
AAAATTACACAGATTAGGTAATGCTGAAGAAAATTTACAA
ATGTAAATCTAATATTTACCTAATACAATAAACAGATTGC
CTATAAAGTCTTGCCTATTACCTTTATGTTATGTGTCCTG
AGAAAAGTAATAAATTATATCACACATAAAAAAATCTATG
TTAAACTTACATTCATTCATTCATTCATTTTCTTGTCGGC
TTAGTCCAGGGG
CTCAGACT 22:36921956-36922534(Forward) 149883bp  upstream grm7p  [glutamate  receptor,  metabotropic  7,  pseudogene] ENSDARG00000078779 [ZDB-GENE-100922-81]; Zv  version:  zv9
5' CCTGCAGCTGGATATATCTCGAAAATTTGGACATGTTTGA
AACAGGTGGATGGAGAGTAAATGAAGTCAGAAATTAAATA
ACAATATACAGTAATATACAGAAACAAATGCCAGAGTGTA
CACACAAAACATTCAGCTATTAAACATCCTACATTTCTGA
AGAATATTATCAGTCTTTGCCAATGACTGTAAAAAAGGCT
GGAACTGACTGTGACGTCNTCAAAACACGTCCTTGCTTAG
CGCTGACTGANCGACGGAAGTGCATACTTTTTACCANAGT
GTCGTTTCCTGAAGCGGGAACCTGTTTTATGGGAATAATC
AAATATTTGCACGGCTGTTACCTGAGTAAGTTTAGCTGAA
TAAGATGTTTTAACTGACCATTACCATTAATGGATAGGTT
GCAGGGAAATAACCTTACATTAAACTGTAACGATAACGTT
ACTTGCTGAAGCCTCTTAAAATCTATCATCACAGTGTGGT
TTTACGCATGTAAACCTGGCGTATAAAGAATTGTTTCGTT
TCTGTAACCAGATAATCAAACANAATANAGCGCTTTCAAA
AACNAGGCTGTTTGTTAATGCTATCTGACGTTACCACCAT
TAACGTTCTTCTGTTAACGTTAANTCCGNATTGCTGGTGA
AACCATTTAACGTTACCATTGTTGCGTGCCNNTGTCATAA
TGTTTGCTACATTCANATGATATGATTGTG
GCTGCAGG
(Reverse complement)
6:24010712-24011391(Forward) exon  0
  AND 
  intron  0
rae1  [RAE1  RNA  export  1  homolog  (S.  pombe)],
rae1  [RAE1  RNA  export  1  homolog  (S.  pombe)]
ENSDARG00000007196 [ZDB-GENE-040426-1029]; ENSDARG00000007196 [ZDB-GENE-040426-1029]; Zv  version:  zv9