Complete Record

Back to Search Results

Line  ID
ws0136 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Ear
Gill
Otolith
Larval:Day6
(6  dpf)
Lateral Epithelial  cells  outside  heart  periphery
Cerebellum
CNS
Neural  Tube
Midbrain-Hindbrain  boundary
Optic  Tectum
Eye

(2  dpf)
Lateral Epiphysis
Ear
Lens
Otolith
Larval:Day5
(5  dpf)
Lateral
Larval:Day5
(5  dpf)
Lateral Posterior  cardinal  vein
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
5' TTTGAACATGTGATAAGAAATGTCATTGAAAAGAAAATAA
CATAGAAGCCATTATCTCATCCATGGTTAAACCAACAACT
AATAATATACCATTCGTAAATCATATGAACCCCACCACCA
CCGTTCTTGTTGAAGGACACTGAATAGACAGAATAAAAAC
AAATAATACTTCAAAAAACTGTTTTTCTTCAGAAAGAACT
TCCAATGGACAGAATTCCAAAAACTAAAATTAGCTAAATA
AATCTTAATAAACCCCTGCCAGGGGGATCTGGCAGAACAA
AAGTATTCTATATAATACTAAAAGATACAGCCCTGCTATT
ATCATCTGCCTGCTACAAAACAGACAGAAAGTTTGTTTGT
TTTTTTTGTTTTTTATGTTTGAAACTGACTTGCTGGGGCA
AAATGTGGCTGTGTTGATGGTTTGGTGCTTGTGGAGGATT
TAGTAAAACATAGCTGTGCTGATTGAGGGGATTGATGCTT
GTGGGGGGTTACCAGACAGTATCAGGAGAGGATGCTTTTA
GTGCATGTGATAATACATTACATAGAAGGTTGCGCGGTGG
CACAGTGAGTACCACTGTCGCCTCACAGCAGGAAGGTTGC
TGGTTCGAGCCATGACTGGGTTCTCCCCATGTTGGCGTGG
GTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTTCAAACA
CATGCAATACAGGTGAATTGGGTAAGCTAAATTGTCCCTA
TTGTATGTGTGTGAAAGAGAGTGTATGGATGTTTCCCAGT
GCTGGGTAGCAGCTGGAAGGGCAGCCACTGCGTAAATCAT
ATGCTGGATAAATTGGGGTTCATTCCACTGTGGCAACCCA
GATTGATAAAGG
TGTTCAAA
(Reverse complement)
7:5437144-5438000(Reverse) 6907bp  upstream CR392362.1  [Uncharacterized  protein] ENSDARG00000055424; Zv  version:  zv9