Complete Record

Back to Search Results

Line  ID
ws0196 No.  of  Inserts Multiple No.  of  Inserts  estimated  by TAIL-PCR
Trapping  Construct
pDsDELGT4 Gene  Trap  Reporter Cherry Enhancer  Trap  Reporter GFP
Expression  Domain(s)
Expression  Domain Image Expressed  at Image  View Remarks
Eye
Lens
Optic  Tectum
Neural  Tube
Hindbrain
Forebrain
Brain
CNS
Pharyngula:Prim-15
(2  dpf)
Lateral
Notochord
Neural  Tube
Optic  Tectum
CNS
Cerebellum
Neuron
Hatching:Pec-fin
(7  dpf)
Dorsal Diencephalon
Ear
Eye
Optic  Tectum
Hatching:Pec-fin
(2  dpf)
Lateral Tegmentum
Neuron
Neural  Tube
Notochord
Tail  Fin
Pharyngula:Prim-15
(2  dpf)
Lateral
Muscle
Neural  Tube
Pharyngula:Prim-15
(2  dpf)
Lateral
Larval:Day5
(5  dpf)
Lateral ws0196-1
Muscle Larval:Day5
(5  dpf)
Lateral ws0196-1a
Insertion(s)
Ds Tail  Sequence
(Insertion site in blue. Ds sequence in red.)
Insertion  Site Genomic  Coordinates Location  of  Insertion Nearest  Gene      (Symbol  &  Name) Nearest  Gene  (ID) Remarks
3' GCGGGgAtggcGGTCAGCTACATCCTCTCGTATCtgCtgg
tgttGctgctgtGTGTGGTGGGCAACGGGCTGGTCTGTCT
GGTGGTCATCAGGAACAGAAACATGCGCTCCGTCACTAAT
CTCTTCATCCTCAACCTGGCCGTCAGCGACCTGCTGGTGG
GCATTTTCTGCGTGCCCACCACACTGATTGACAGCCTCAT
GCGGGgAt 10:42330564-42330763(Reverse) exon  0 npffr1l1  [neuropeptide  GnIHR1] ENSDARG00000054203 [ZDB-GENE-091118-18]; Zv  version:  zv9
3' AACCTAAC AACCTAAC 1:20205236-20205244(Reverse) 416bp  downstream glrba  [gylcine  receptor,  beta  a] ENSDARG00000052782 [ZDB-GENE-010410-2]; Zv  version:  zv9
ws01961,  Insertion  site  resolved  by  NGS
3' GCAGAAGG GCAGAAGG 25:32256224-32256231(Forward) exon  5 tnnt3a  [troponin  T3a,  skeletal,  fast] ENSDARG00000030270 [ZDB-GENE-000322-3]; Zv  version:  zv9
ws01961a,  Insertion  site  resolved  by  NGS