The Ds sequences used for transposon insertions are as follows:

5' Ds sequence:
CAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGATTTTGTTAGTTTTATCCCGATCGATTTCGAACCCGAG GTAAAAAACGAAAACGGAACGGAAACGGGATATACAAAACGGTAAACGGAAACGGAAACGGTAGAGCTAGTTTCCCGACCGTTTCACCGGG ATCCCGTTTTTAATCGGGATGATCCCGTTTCGTTACCGTATTTTCTAATTCGG

3' Ds sequence:
AGTAGACTTATATGGCTTCTTATGTTAGCCAAGAGCCCAAGACTTATCACTTATGTGCTACATTAAACTATGTGTGCTCCAGATTTATATGGA TTTTATCTATGTTTAATTAAGACTTGTGTTTACAATTTTTTATATTTGTTTTTAAGTTTTGAATATATGTTTTCATGTGTGATTTTACCGAAC AAAAATACCGGTTCCCGTCCGATTTCGACTTTAACCCGACCGGATCGTATCGGTTTTCGATTACCGTATTTATCCCGTTCGTTTTCGTTACCG GTATATCCCGTTTTCGTTTCCGTCCCGCAAGTTAAATATGAAAATGAAAACGGTAGAGGTATTTTACCGACCGTTACCGACCGTTTTCATCCCTA

The DsDELGT4 construct used is shown below: